Adeko 14.1
Request
Download
link when available

Human Pgk Promoter, Contains MCS downstream of H2B-mCherry

Human Pgk Promoter, Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. 2 surface marker under control of the human PGK promoter. These results suggest that the PGK-puro cassette is necessary to obtain the enhanced expression of a co-existing human cDNA in the mouse Ttr locus, even though the expression of co-existing cDNA was under the control of the mouse endogenous promoter. In addition to the role of glycolysis, PGK-1 acts as a polymerase alpha cofactor Complete information for PGK1 gene (Protein Coding), Phosphoglycerate Kinase 1, including: function, proteins, disorders, pathways, orthologs, and expression. Mouse phosphoglycerate kinase 1 promoter. com. All products are for internal research use only, and not for human or veterinary use. 1371/journal. We systematically assessed the ability of different promoters to direct expression of foreign transgenes in primary murine neocortical neurons, cerebellar granule cells and in undifferentiated and differentiated neuroblastoma cells. For our study, we selected the constitutive human phosphoglycerate kinase (PGK) promoter for gene A, and 6xNFAT for gene B. The promoter of the mouse pgk-1 gene is homologous to the human pgk-1 promoter. We used ligation-mediated polymerase chain reaction (PCR) for a genomic sequencing study in which 450 bp of the human PGK-1 promoter region was analyze … The vectors using the MSCV LTR, the GALV LTR, and the PGK promoter were the most efficient at transducing primary human CD34+ cord blood progenitors under the conditions employed. gb Articles Citing this Plasmid These results suggest that the PGK-puro cassette is necessary to obtain the enhanced expression of a co-existing human cDNA in the mouse Ttr locus, even though the expression of co-existing cDNA was under the control of the mouse endogenous promoter. Sticky ends from different BsmI sites may not be compatible. Sep 10, 2020 · In my case, I'm trying to express GFP using retrovirus with hPGK promoter, but it doesn't work. These vector and virus products come as a set of three sgRNA targets which are designed to guide Cas9 to cleave exonic gDNA resulting in frameshift mutations and ultimately gene knockout. This vector contains the following features: Human phosphoglycerate kinase (PGK) promoter provides low translational expression, which is advantageous when a reduction of signal is the desired response. The PGK promoter had predominant expression in both RGCs and AII amacrine cells. Jun 23, 2020 · In this paper, we report a side-by-side comparison between four commonly used promoters: the short CMV early enhancer/chicken β actin (sCAG), human cytomegalovirus (hCMV), mouse Find and order plasmides and products like this Human UTRN CRISPR gRNA in Lenti Particles on www. 501M. Human PGK (hPGK) is a 45-kDa monomeric protein consisting of two domains: an amino- (N-) terminal domain that binds to 1, 3-bPG or 3PG and a carboxyl- (C-) terminal domain containing a nucleotide-binding site. The Pgk-1 promoter is in a region rich in nucleotides G and C. This promoter can efficiently drive high levels of expression of reporter genes such as E. The stability of gene expression was monitored for up to 7 weeks in culture and the MSCV promoter-containing vector was found to be comparable to the cellular PGK promoter-containing vector. Thus, the Pgk-1 promoter drives transgene expression in all tissues but the levels of expression are not uniform in each cell. The ubiquitous CBA, CMV, and sCAG promoters expressed eGFP in a variety of cell types across multiple retinal UniProt is the world's leading high-quality, comprehensive and freely accessible resource of protein sequence and functional information. If you want to express human protein in mouse cells, you need to check weather this native protein expressed in mouse cells first. The promoter region is extremely G + C-rich, lacks a TATA box, and has an 8-bp direct repeat. Fujii H, Yoshida A (1981). eCollection 2016. I'm searched articles, and most of them says hPGK promoter is OK to express genes in mouse May 12, 2010 · Here, we carried out a systematic comparison of eight commonly used constitutive promoters (SV40, CMV, UBC, EF1A, PGK and CAGG for mammalian systems, and COPIA and ACT5C for Drosophila systems). PMID 3453121. PGK domain movement and catalysis is regulated by a spring-loaded release mechanism Phosphoglycerate kinase 1 (PGK1) showed a difference between follicular cells from follicles leading to a pregnancy or developmental failure. We have determined that the 120 bp upstream of the transcription start site functions as a core promoter. First Fragment for 2 Fragment MultiSite Gateway LR reaction. genomics-online. Contains a Hygromycin selection cassette. "Human testis-specific PGK gene lacks introns and possesses characteristics of a processed gene". Gene/Insert name eGFP Insert Size (bp) 720 Promoter PGK promoter Cloning Information Cloning method Gibson Cloning 5′ sequencing primer cattctgcacgcttcaaaag 3′ sequencing primer ggcaactagaaggcacagtc (Common Sequencing Primers) Resource Information Supplemental Documents PGK plasmid. Cleavage may be enhanced when more than one copy of the EarI recognition sequence is present. Order product ABIN5111180. This plasmid is available through Addgene. In contrast, the CMV promoter activity was the strongest in the differentiated cells. 326. 326 (6112): 501–5. The EF-1α and PGK were the strongest promoters in those cells, while the activities of these promoters became weak after the differentiation induced by all- trans retinoic acid. Although the PGK promoter is generally regarded as constitutive it can be regulated to some extent by carbon source (2,1 J) Yeast cells utilize nonfermentable car bon The promoter of the yeast gene encoding the glycolytic enzyme phosphoglycerate kinase (PGK) has been used to construct vectors for expression of heterologous proteins The promoter region of the X-linked human phosphoglycerate kinase-1 (PGK-1) gene is a CpG island, similar to those often found near autosomal genes. The PGK promoter drives expression of a glycolytic protein required at a high level in yeast cells utilizing glucose by fermentation, precisely the condi tions in which yeast cells are grown in many different applications. Depositor Comments Multisite Gateway Entry Clone for human PGK Promoter. microRNA reporter relying on a bidirectional PGK promoter. Bibcode: 1987Natur. coli lacZ and neo . Available constructs include All-in-One (Cas9 and sgRNA expression) and sgRNA only Gene/Insert name eGFP Insert Size (bp) 720 Promoter PGK promoter Cloning Information Cloning method Gibson Cloning 5′ sequencing primer cattctgcacgcttcaaaag 3′ sequencing primer ggcaactagaaggcacagtc (Common Sequencing Primers) Resource Information Supplemental Documents PGK plasmid. "Molecular abnormality of phosphoglycerate kinase-Uppsala associated with chronic nonspherocytic hemolytic It is thus shown that vectors containing the EF1α and, to a lesser extent, the phosphoglycerate kinase (PGK) promoter, govern high-level gene expression in human hematopoietic progenitors as well as derived hematopoietic lineages of therapeutic relevance, such as erythrocytes, granulocytes, monocytes, dendritic cells, and megakaryocytes. CMV, UBB, α-actin, and Pgk promoters all showed sustained expression in muscle for at least 57 days, while SV40 only supported expression for up to three weeks. Typical of other housekeeping genes, the promoter for the human hypoxanthine phosphoribosyl transferase-encoding gene (HPRT) is G + C-rich, lacks a TA… user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide or amino acid matches over the alignment, expressed as a The catalytically active fully closed conformation of human phosphoglycerate kinase in complex with ADP and 3-phosphoglycerate. gRNA PExp, GEEN Lentiviral Vector pLenti-U6-sgRNA-PGK-Neo Ampicillin U6 Promoter unconjugated Stable Human ube3a cDNA Clone in Bacterial Expression Vector (His-GST) cDNA Clon Bacterial Expression Vector pPB-His-GST Kanamycin T7 Promoter His-GST Transient Human ube3a cDNA Clone in Bacterial Expression Vector (His-MBP) gRNA PExp, GEEN Lentiviral Vector pLenti-U6-sgRNA-PGK-Neo Ampicillin U6 Promoter unconjugated Stable Human WDR78 cDNA Clone in Bacterial Expression Vector (His-GST) cDNA Clon Bacterial Expression Vector pPB-His-GST Kanamycin T7 Promoter His-GST Transient Human WDR78 cDNA Clone in Bacterial Expression Vector (His-MBP) gRNA PExp, GEEN Lentiviral Vector pLenti-U6-sgRNA-PGK-Neo Ampicillin U6 Promoter unconjugated Stable Human RAP2A cDNA Clone in Mammalian Expression Vector (His tag) cDNA PExp Mammalian Expression Vector pPM-C-His Kanamycin CMV Promoter His tag Stable Human RAP2A cDNA Clone in Bacterial Expression Vector (His tag) gRNA PExp, GEEN Lentiviral Vector pLenti-U6-sgRNA-PGK-Neo Ampicillin U6 Promoter unconjugated Stable Human RPS26 cDNA Clone in Bacterial Expression Vector (His-GST) cDNA Clon Bacterial Expression Vector pPB-His-GST Kanamycin T7 Promoter His-GST Transient Human RPS26 cDNA Clone in Mammalian Expression Vector (His tag) gRNA PExp, GEEN Lentiviral Vector pLenti-U6-sgRNA-PGK-Neo Ampicillin U6 Promoter unconjugated Stable Human UBE2B cDNA Clone in Bacterial Expression Vector (His-GST) cDNA Clon Bacterial Expression Vector pPB-His-GST Kanamycin T7 Promoter His-GST Transient Human UBE2B cDNA Clone in Bacterial Expression Vector (His-MBP) gRNA PExp, GEEN Lentiviral Vector pLenti-U6-sgRNA-PGK-Neo Ampicillin U6 Promoter unconjugated Stable Human SCN2B cDNA Clone in Bacterial Expression Vector (His-GST) cDNA Clon Bacterial Expression Vector pPB-His-GST Kanamycin T7 Promoter His-GST Transient Human SCN2B cDNA Clone in Bacterial Expression Vector (His-MBP) Here, we tested two well-characterized, non-viral promoters, murine phosphoglycerate kinase (mPGK) and human PGK (hPGK) in lentiviral vectors (LV) expressing canine CD18 for gene therapy of canine leukocyte adhesion deficiency (CLAD). Although the PGK promoter is generally regarded as constitutive it can be regulated to some extent by carbon source (2,1 J) Yeast cells utilize nonfermentable car bon Typical of other housekeeping genes, the promoter for the human hypoxanthine phosphoribosyl transferase-encoding gene (HPRT) is G + C-rich, lacks a TA… The promoter of the mouse pgk-1 gene is homologous to the human pgk-1 promoter. Plasmid p5E-hPGK from Dr. GeneCards - The Human Gene Compendium At first, we transduced those HIV vectors into acute promyelocyte leukemia NB4 cells. These were human cytomegalovirus (CMV) promoter/enhancer, human phosphoglycerate kinase (PGK) promoter, myelin basic protein (MBP) promoter, glial fibrillary acidic protein (GFAP) promoter, MND (a modified LTR U3 region of MoMuLV, in which the enhancer sequence was replaced by myeloproliferative sarcoma virus enhancer and the negative control The PgK promoter was the weakest of all five, and gave expression only about one-tenth of the CMV promoter in muscle. A number of conserved motifs in the promoter may indicate a significant role for these sequences in expression of the pgk-1 gene. human PGK1 promoter will initial human protein well. Methodology/Principal Findings We have quantitatively compared promoter activities of five commonly used constitutive promoters, including the human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor-1α, (EF1α), phosphoglycerate kinase (PGK) and ubiquitinC (UbC) in hESCs. 1038/326501a0. Kryn Stankunas's lab contains the insert Human PGK promoter and is published in PLoS One. Here, we tested two well-characterized, non-viral promoters, murine phosphoglycerate kinase (mPGK) and human PGK (hPGK) in lentiviral vectors (LV) expressing canine CD18 for gene therapy of canine leukocyte adhesion defi ciency (CLAD). . S2CID 4353366. pone. gb Articles Citing this Plasmid We aimed to evaluate the pathological progression value and prognostic values of PGK1 mRNA high expression, PGK1 promoter methylation, and PGK1 mediated-PDHK1 activating phosphorylation in multiple human cancers. We offer a variety of promoters to drive target gene expression including promoters for mammalian, plant, zebrafish, yeast and drosophila gene expression. In PBLs, vectors containing the MSCV promoter were found to be optimal for expression in both minimally stimulated and highly activated lymphocytes. The PGK promoter is a nonviral universal promoter, which functions across cell lines (yeast, rat, mouse and human). coli lacZ and neo. 2016 Aug 8;11 (8):e0159277. This evidence suggests that PGK is a key enzyme for glycolytic flux control by sensing the [ATP]/ [ADP] ratio. The PGK promoter drives expression of a glycolytic protein required at a high level in yeast cells utilizing glucose by fermentation, precisely the conditions in which yeast cells are grown in many different applications. Retroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90. 7k Plasmids: Basic Cloning Vectors | More Plasmid Sets. Nature. Data show that PGK1 regulates the expression of CXCR4 and beta-catenin at the mRNA and protein levels. The codon-optimized human RAB27Aco transgene was cloned into different lentiviral backbone plasmids with a mild constitutively active promoter (PGK), a methylation-resistant promoter (UCOE), and a strong constitutively active promoter (SFFV) and respectively named PGK-RAB27Aco, UCOE-RAB27Aco, and SFFV-RAB27Aco (Figure S1) [30, 31]. Explore Over 2. 0159277. Although Pgk-1 is X-linked and subject to X chromosome inactivation, the transgenes were not inactivated in either female somatic or male germ cells. Phosphoglycerate kinase 1 (PGK1) is the first enzyme in glycolysis to generate a molecule of ATP in the conversion of 1,3-bisphosphoglycerate (1,3-BPG) to 3-phosphoglycerate (3-PG). abm vector design studio abm 's Knockout sgRNA vectors and viruses are ready to use in your CRISPR Gene Knockout experiment. A comparison of the promoter region for PGK with other promoters on the X-chromosome reveals homology with the promoter for HPRT, but not with the operator for factor IX. doi: 10. The nucleotide sequence of the promoter region of this gene and its transcription start point are compared with those of Pgk-1, an intron-containing, X-linked, housekeeping gene expressed constitutively in all somatic cells and premeiotic germ cells. Phosphoglycerate kinase (PGK) is a central glycolytic enzyme that is associated with the survival of every organism, and mutations in PGK result in a number of metabolic disorders, including mental retardation, neurological disorders and rhabdomyolysis [4]. Sticky ends from different EarI sites may not be compatible. PGK is highly conserved in structure, but changes in N-terminal polar amino acid content will lead to differences in PGK structure, which is determined by different environmental adaptation temperatures and other factors. Although the PGK promoter is generally regarded as constitutive it can be regulated to some extent by carbon source (2, 11). High-level GFP expression in the NOD/SCID xenograft model was demonstrated with the pHR’ derivative bearing the MSCV LTR. uthq, hcah, kvch, fclm, nafde, ws0kg8, flcakm, qfz1, emvu, ct4i,